Top » Catalog » SNPs » A11385

$18.00

A11385
[A11385]

A11385
hg38 Position: ChrY:16485436..16485436
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11385_F TGCAACCATTTAAAATACATGGC
Reverse Primer: A11385_R AGACAGATGTCCAACAAAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10971
1 x A10245
1 x A11226
1 x A10942
$72.00
Haplogroup Info
Other products
Currencies