Top » Catalog » SNPs » A11387

$18.00

A11387
[A11387]

A11387
HG19 Position: ChrY:19386328..19386328
Ancestral: A
Derived: G
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11387_F CCCAGTTAGGTGGTATAGGAAGG
Reverse Primer: A11387_R ACTGTTGGAGCTGCCTGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies