Top » Catalog » SNPs » A11388

$18.00

A11388
[A11388]

A11388
hg38 Position: ChrY:13836126..13836126
Ancestral: C
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11388_F TTTAATGGTCGGAGTATTAGAAAGAAG
Reverse Primer: A11388_R CCTACATAGCCAAGGTCCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies