Top » Catalog » SNPs » A11371

$18.00

A11371
[A11371]

A11371
HG19 Position: ChrY:14608833..14608833
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Below A2512
Forward Primer: A11371_F CCAGCCCTTACAGAAATAACTCAC
Reverse Primer: A11371_R CGGTAGTAGTTGACCGTGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies