Top » Catalog » SNPs » A11373

$18.00

A11373
[A11373]

A11373
HG19 Position: ChrY:22233644..22233644
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Below A2512
Forward Primer: A11373_F CCCTCCTTTGAAATGCACAC
Reverse Primer: A11373_R CCACAGCCTGAGCATCATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11509
1 x A11077
1 x A10884
1 x A10674
$72.00
Haplogroup Info
Other products
Currencies