Top » Catalog » SNPs » A11376

$18.00

A11376
[A11376]

A11376
hg38 Position: ChrY:13115604..13115604
Ancestral: G
Derived: C
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11376_F AGGCTTCTTCACCTGCTGG
Reverse Primer: A11376_R TAGAGTGGGAGAGCCAATGG
Reviews

Customers who bought this product also purchased
A11377
A11377
A11375
A11375
A8050
A8050
R1b-S6881 Panel
R1b-S6881 Panel
S6881
S6881
A11379
A11379
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies