Top » Catalog » SNPs » A11376

$18.00

A11376
[A11376]

A11376
HG19 Position: ChrY:13115604..13115604
Ancestral: G
Derived: C
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11376_F AGGCTTCTTCACCTGCTGG
Reverse Primer: A11376_R TAGAGTGGGAGAGCCAATGG
Reviews

Customers who bought this product also purchased
S6881
S6881
A11379
A11379
A11378
A11378
A11377
A11377
A11375
A11375
A8050
A8050
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies