Top » Catalog » SNPs » A11376

$18.00

A11376
[A11376]

A11376
hg38 Position: ChrY:13115604..13115604
Ancestral: G
Derived: C
Reference: Ray Warburton (2016)
ISOGG Haplogroup: R1b1a1a2a (not listed)
Comments: Downstream of L151
Forward Primer: A11376_F AGGCTTCTTCACCTGCTGG
Reverse Primer: A11376_R TAGAGTGGGAGAGCCAATGG
Reviews

Customers who bought this product also purchased
BZ2
BZ2
CTS7080
CTS7080
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Z9
Z9
Z343
Z343
R1b-L48 Panel
R1b-L48 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies