Top » Catalog » SNPs » A11227

$18.00

A11227
[A11227]

A11227
HG19 Position: ChrY:13345232..13345232
Ancestral: C
Derived: T
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222 > DF105 > ZS8379
Forward Primer: A11227_F CAATGGAACCCAACCACG
Reverse Primer: A11227_R CATAGACTAGTCAGCTTCCAGTTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10071
1 x A11622
1 x A10580
1 x A10318
1 x A1
$90.00
Haplogroup Info
Other products
Currencies