Top » Catalog » SNPs » A11242

$18.00

A11242
[A11242]

A11242
HG19 Position: ChrY:8380974..8380974
Ancestral: T
Derived: C
Reference: Michael Kaehler (2016)
ISOGG Haplogroup: R1b
Comments: Below M222 > A223 > A823 > A984
Forward Primer: A11242_F ATCACACCTGGTTTCAGTTCTG
Reverse Primer: A11242_R ATTACATAATGCTGAGCCCAGG
Reviews

Customers who bought this product also purchased
A11245
A11245
A743
A743
A984
A984
A11243
A11243
A11244
A11244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies