Top » Catalog » SNPs » A11246

$18.00

A11246
[A11246]

A11246
HG19 Position: ChrY:7909328..7909328
Ancestral: C
Derived: T
Reference: Michael Kaehler (2016)
ISOGG Haplogroup: R1b
Comments: Below M222 > A223 > A823 > A984
Forward Primer: A11246_F TTAGTACAGATGGAGTTTCACCACA
Reverse Primer: A11246_R TGCAAAGATCTGTGAGAGAATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10317
1 x A11211
1 x A11363
1 x A1064
1 x A11276
1 x A1159
$108.00
Haplogroup Info
Other products
Currencies