Top » Catalog » SNPs » A11247

$18.00

A11247
[A11247]

A11247
HG19 Position: ChrY:6715671..6715671
Ancestral: C
Derived: T
Reference: Michael Kaehler (2016)
ISOGG Haplogroup: R1b
Comments: Below M222 > A223 > A823 > A984
Forward Primer: A11247_F CCTAAGGTGTCTGACTCAGAAGG
Reverse Primer: A11247_R GCCAGAGCACACTGAGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies