Top » Catalog » SNPs » A11248

$18.00

A11248
[A11248]

A11248
hg38 Position: ChrY:7695776..7695776
Ancestral: C
Derived: T
Reference: Michael Kaehler (2016)
ISOGG Haplogroup: R1b
Comments: Below M222 > A223 > A823 > A984
Forward Primer: A11248v2_F GTTTCTTACTGATCAGTGATTCACG
Reverse Primer: A11248v2_R AAGACATCATGATCTTATCTCAATACTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies