Top » Catalog » SNPs » A11391

$18.00

A11391
[A11391]

A11391
HG19 Position: ChrY:3000406..3000406
Ancestral: C
Derived: T
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222 > DF104 > DF105 > ZS8379 > A10316
Forward Primer: A11391_F CTGTGTTACTGATCTTTGTAGCCAG
Reverse Primer: A11391_R CAATTGACCTGCCTTAAATTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies