Top » Catalog » SNPs » A11471

$18.00

A11471
[A11471]

A11471
hg38 Position: ChrY:7340922..7340922
Ancestral: T
Derived: A
Reference: Colin Ferguson (2016)
ISOGG Haplogroup: I2 (not listed)
Comments: Below Y4750 > A9403/BY3821
Forward Primer: A11471_F CCCTCTCCATGTCAGCGTATAG
Reverse Primer: A11471_R ACCACGCTCCCTTTACCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies