Top » Catalog » SNPs » A11473

$18.00

A11473
[A11473]

A11473
HG19 Position: ChrY:19836627..19836627
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: unknown
Comments: Invalid SNP due to typo in ChrY position
Forward Primer: A11473_F GGATTACATTTATTGATTTGCATACG
Reverse Primer: A11473_R TCTGAATAGACCAATAAAAGGCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies