Top » Catalog » SNPs » A11428

$18.00

A11428
[A11428]

A11428
HG19 Position: ChrY:14476336..14476336
Ancestral: G
Derived: A
Reference: Janet Akaha (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC14600
Forward Primer: A11428_F AGAGCTGCTTGGTTTGCAG
Reverse Primer: A11428_R TCACTGCAAAGGACATCAAAAG
Reviews

Customers who bought this product also purchased
A11429
A11429
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies