Top » Catalog » SNPs » A11429

$18.00

A11429
[A11429]

A11429
HG19 Position: ChrY:16606678..16606678
Ancestral: C
Derived: T
Reference: Janet Akaha (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC14600
Forward Primer: A11429_F GGGGACACAAACATTTTATGC
Reverse Primer: A11429_R CAAGATAAATAGAGATGGCAGGTG
Reviews

Customers who bought this product also purchased
A11428
A11428
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11603
1 x A11687
1 x A10723
1 x A11114
1 x A10762
$90.00
Haplogroup Info
Other products
Currencies