Top » Catalog » SNPs » A11429

$17.50

A11429
[A11429]

A11429
HG19 Position: ChrY:18718558..18718558
Ancestral: C
Derived: T
Reference: Janet Akaha (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC14600
Forward Primer: A11429_F GGGGACACAAACATTTTATGC
Reverse Primer: A11429_R CAAGATAAATAGAGATGGCAGGTG
Reviews

Customers who bought this product also purchased
A11428
A11428
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies