Top » Catalog » SNPs » A11480

$17.50

A11480
[A11480]

A11480
HG19 Position: ChrY:19380677..19380677
Ancestral: T
Derived: C
Reference: Joe Fox (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11480_F GTCACAGTGAACTCATACAAGGATC
Reverse Primer: A11480_R CGTGTGGTCAACATGTGCAC
Reviews

Customers who bought this product also purchased
A11477
A11477
A11475
A11475
A11479
A11479
A11478
A11478
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies