Top » Catalog » SNPs » A11483

$18.00

A11483
[A11483]

A11483
HG19 Position: ChrY:7746669..7746669
Ancestral: A
Derived: C
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11483_F AAACTCCAGTGCACATAAGCTG
Reverse Primer: A11483_R AATAGTTAGGACTACGAGCATGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies