Top » Catalog » SNPs » A11484

$18.00

A11484
[A11484]

A11484
HG19 Position: ChrY:7805806..7805806
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11484_F TACCTAGGTGGGTGCTGGTC
Reverse Primer: A11484_R TCCAGGTCCATTGTGTAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies