Top » Catalog » SNPs » A11485

$18.00

A11485
[A11485]

A11485
HG19 Position: ChrY:7812896..7812896
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11485_F GGCTGGGCCCATGTATTAG
Reverse Primer: A11485_R TGAATCTCCTTTCCGTCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10841
1 x A10662
1 x A10291
1 x A11660
$72.00
Haplogroup Info
Other products
Currencies