Top » Catalog » SNPs » A11486

$18.00

A11486
[A11486]

A11486
HG19 Position: ChrY:8226164..8226164
Ancestral: C
Derived: G
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11486_F ATTTAATACACTGTTCCTGTGAATTAATG
Reverse Primer: A11486_R ATTTAAAGAGTATATAAGTATTGCATACCAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1096
$18.00
Haplogroup Info
Other products
Currencies