Top » Catalog » SNPs » A11487

$18.00

A11487
[A11487]

A11487
HG19 Position: ChrY:14288400..14288400
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11487_F GCAATATATATTGTAGATGCATAACCATG
Reverse Primer: A11487_R GAAAATTATGTTTTTACTGTTAGATTAGGTTGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies