Top » Catalog » SNPs » A11489

$18.00

A11489
[A11489]

A11489
hg38 Position: ChrY:13391995..13391995
Ancestral: A
Derived: C
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11489_F CACCAGCTCTTCTCATTTATTGG
Reverse Primer: A11489_R TTCATAACCTGCCATTCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10118
1 x A10615
1 x A11676
1 x A10289
1 x A10760
$90.00
Haplogroup Info
Other products
Currencies