Top » Catalog » SNPs » A11490

$17.50

A11490
[A11490]

A11490
HG19 Position: ChrY:17576327..17576327
Ancestral: G
Derived: T
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11490_F TTGGAAAACTGAGGCAGAAG
Reverse Primer: A11490_R TGCACATCAGGCAAGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies