Top » Catalog » SNPs » A11491

$18.00

A11491
[A11491]

A11491
HG19 Position: ChrY:15732474..15732474
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11491_F GTACAGTTTAATGCACAAGCAATTTAG
Reverse Primer: A11491_R AATAGTGTGAGTAGTATCTCTTTGAGTGATAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10634
1 x A10999
1 x A11538
1 x A10981
1 x A10527
1 x A10029
1 x A11154
$126.00
Haplogroup Info
Other products
Currencies