Top » Catalog » SNPs » A11492

$17.50

A11492
[A11492]

A11492
HG19 Position: ChrY:18005293..18005293
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11492_F AGAAGACTATTTATAGTAAATTAAAGGGAGC
Reverse Primer: A11492_R AATTGTTATAGTATTTTTAAATAAGTGATGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies