Top » Catalog » SNPs » A11492

$18.00

A11492
[A11492]

A11492
HG19 Position: ChrY:15893413..15893413
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11492_F AGAAGACTATTTATAGTAAATTAAAGGGAGC
Reverse Primer: A11492_R AATTGTTATAGTATTTTTAAATAAGTGATGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10849
1 x A11479
1 x A10960
1 x A11308
$72.00
Haplogroup Info
Other products
Currencies