Top » Catalog » SNPs » A11493

$17.50

A11493
[A11493]

A11493
HG19 Position: ChrY:18163716..18163716
Ancestral: C
Derived: A
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11493_F GTATACAAGTTTGTATGGGTGTAGGTTAG
Reverse Primer: A11493_R CAAGGTGCTGACCACAAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies