Top » Catalog » SNPs » A11495

$18.00

A11495
[A11495]

A11495
HG19 Position: ChrY:19224806..19224806
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11495_F CACTAATCTACTTTGTCTCCATATCTTG
Reverse Primer: A11495_R CAAGCCAATCATAGTAATGCTATCAC
Reviews

Customers who bought this product also purchased
A11500
A11500
A11499
A11499
A11498
A11498
A11501
A11501
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies