Top » Catalog » SNPs » A11499

$18.00

A11499
[A11499]

A11499
HG19 Position: ChrY:21406518..21406518
Ancestral: C
Derived: T
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257
Forward Primer: A11499_F ATTCGGGATGGCTGACAG
Reverse Primer: A11499_R CCATGAGACTCTAGTGGTTTCATG
Reviews

Customers who bought this product also purchased
A11495
A11495
A11501
A11501
A11500
A11500
A11498
A11498
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies