Top » Catalog » SNPs » A11505

$17.50

A11505
[A11505]

A11505
HG19 Position: ChrY:15276107..15276107
Ancestral: A
Derived: G
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257 > S5750
Forward Primer: A11505_F GCCCTAAGGGATCACCTACTC
Reverse Primer: A11505_R ATACAGGCATGCATCAGCAC
Reviews

Customers who bought this product also purchased
S5442
S5442
A11508
A11508
A11502
A11502
A11507
A11507
A11506
A11506
S5437
S5437
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies