Top » Catalog » SNPs » A11508

$18.00

A11508
[A11508]

A11508
hg38 Position: ChrY:17268324..17268324
Ancestral: G
Derived: T
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream L257 > S5750
Forward Primer: A11508_F CAAAGTTGCATTATTCCAAAGTG
Reverse Primer: A11508_R ATGTGAAACAAAAACAGTACGCTTAC
Reviews

Customers who bought this product also purchased
S5437
S5437
A11505
A11505
A11504
A11504
S5442
S5442
A11507
A11507
A11502
A11502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies