Top » Catalog » SNPs » A11509

$18.00

A11509
[A11509]

A11509
HG19 Position: ChrY:14857825..14857825
Ancestral: T
Derived: C
Reference: Neil Bowie (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11509_F GGATCCAATGGTTCAAAAGG
Reverse Primer: A11509_R TATGGAATGCAGCAATGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11697
1 x A11653
1 x A11007
$54.00
Haplogroup Info
Other products
Currencies