Top » Catalog » SNPs » A11510

$18.00

A11510
[A11510]

A11510
HG19 Position: ChrY:16004723..16004723
Ancestral: A
Derived: G
Reference: Neil Bowie (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11510_F ACTCTGTGGGGACAGACACTG
Reverse Primer: A11510_R TGACAATCAACATAGAAGCTGTCTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies