Top » Catalog » SNPs » A11511

$18.00

A11511
[A11511]

A11511
hg38 Position: ChrY:14768962..14768962
Ancestral: G
Derived: A
Reference: Michael Clarke (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a (not listed)
Comments: Below DF49 > M222 > DF104
Forward Primer: A11511_F ACAGATAATACTTATTTAAACTTACAGCGG
Reverse Primer: A11511_R CCTTATTTTATTTTTTCAAATGGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10514
1 x A10563
$36.00
Haplogroup Info
Other products
Currencies