Top » Catalog » SNPs » A11512

$18.00

A11512
[A11512]

A11512
HG19 Position: ChrY:16790114..16790114
Ancestral: T
Derived: C
Reference: Michael Clarke (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a (not listed)
Comments: Below DF49 > M222 > DF104
Forward Primer: A11512_F CCTTGTTAATTTAATGCCTACCTCAC
Reverse Primer: A11512_R AAAATGCAAGGTGATGAAAGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies