Top » Catalog » SNPs » A11513

$18.00

A11513
[A11513]

A11513
HG19 Position: ChrY:22251224..22251224
Ancestral: G
Derived: A
Reference: Michael Clarke (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a (not listed)
Comments: Below DF49 > M222 > DF104
Forward Primer: A11513_F GAATGTTGGATATTCCACTTGC
Reverse Primer: A11513_R GCTAGACCAAGCCACCCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11620
1 x A10721
$36.00
Haplogroup Info
Other products
Currencies