Top » Catalog » SNPs » A11514

$18.00

A11514
[A11514]

A11514
HG19 Position: ChrY:17040378..17040378
Ancestral: C
Derived: T
Reference: Michael Clarke (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a (not listed)
Comments: Below DF49 > M222 > DF104
Forward Primer: A11514_F ATCCAAACAGGGTAATCGAGG
Reverse Primer: A11514_R GGACAATTGTTGAGTCCAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1071
1 x A1063
1 x A11440
1 x A10221
1 x A10140
1 x A10270
1 x A10180
1 x A1157
$144.00
Haplogroup Info
Other products
Currencies