Top » Catalog » SNPs » A11518

$17.50

A11518
[A11518]

A11518
HG19 Position: ChrY:7646986..7646986
Ancestral: T
Derived: C
Reference: Michael Clarke (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a (not listed)
Comments: Below DF49 > M222 > DF104
Forward Primer: A11518_F TCCATTGTGTGATATACCATGGTC
Reverse Primer: A11518_R TTTTTCCACTGACAATAGCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies