Top » Catalog » SNPs » A11519

$18.00

A11519
[A11519]

A11519
HG19 Position: ChrY:7367394..7367394
Ancestral: A
Derived: G
Reference: Nigel McCarthy (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > P314 > L362 > ZS4606 > ZS4598
Forward Primer: A11519_F CAGCTGGGTCTTGGTATGTG
Reverse Primer: A11519_R CCCAGTTACTCAGGAGGTGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies