Top » Catalog » SNPs » A11520

$17.50

A11520
[A11520]

A11520
HG19 Position: ChrY:17667974..17667974
Ancestral: C
Derived: A
Reference: Nigel McCarthy (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > P314 > L362 > ZS4606 > ZS4598
Forward Primer: A11520_F AAGGATGTTGTGCAATTCCTG
Reverse Primer: A11520_R ACACCCAGTTTAGAATGTTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies