Top » Catalog » SNPs » A11521

$18.00

A11521
[A11521]

A11521
HG19 Position: ChrY:17290624..17290624
Ancestral: G
Derived: A
Reference: Nigel McCarthy (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > P314 > L362 > ZS4606 > ZS4598
Forward Primer: A11521_F ATATGAAAAAATAATCACAAAGCCAG
Reverse Primer: A11521_R TGAGTCAATTAAGTCTCCTTCCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10303
1 x A10729
1 x A11005
$54.00
Haplogroup Info
Other products
Currencies