Top » Catalog » SNPs » A11522

$18.00

A11522
[A11522]

A11522
HG19 Position: ChrY:21182216..21182216
Ancestral: C
Derived: A
Reference: Nigel McCarthy (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF21 > P314 > L362 > ZS4606 > ZS4598
Forward Primer: A11522_F CAAAGCTAAAAGGTTTAGTCATTGTG
Reverse Primer: A11522_R CCTGTAGGGAAGTATTTGGTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10639
1 x A10755
1 x A1158
1 x A11512
1 x A10685
1 x A10930
1 x A10312
1 x A11653
1 x A11396
1 x A10151
1 x A11081
1 x A11414
$216.00
Haplogroup Info
Other products
Currencies