Top » Catalog » SNPs » A11472

$17.50

A11472
[A11472]

A11472
HG19 Position: ChrY:6865452..6865452
Ancestral: C
Derived: T
Reference: Timo Rossi (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L238
Forward Primer: A11472_F CAGTAGTTTAAAGCCACAAAGGATG
Reverse Primer: A11472_R CTCCAGAGAATAATTTGTTCTGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies