Top » Catalog » SNPs » A11523

$18.00

A11523
[A11523]

A11523
HG19 Position: ChrY:18614987..18614987
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Below A2512
Forward Primer: A11523_F ACTATGACCATAATCAACACCATTATTATC
Reverse Primer: A11523_R CAATAAACAAAGCTACACTCCTTCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies