Top » Catalog » SNPs » A11526

$18.00

A11526
[A11526]

A11526
HG19 Position: ChrY:19521589..19521589
Ancestral: T
Derived: A
Reference: Iain Kennedy (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z251
Forward Primer: A11526v2_F GTGCAAAAATATTGTGAGAGGC
Reverse Primer: A11526v2_R CCAGTCCTATTGATTTGTACTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies