Top » Catalog » SNPs » A11527

$18.00

A11527
[A11527]

A11527
HG19 Position: ChrY:16257104..16257104
Ancestral: A
Derived: G
Reference: George Jamieson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11527_F AGATTATCATGAGCCTGTTCAGG
Reverse Primer: A11527_R TTGTGTAAATGCAGGATGGTG
Reviews

Customers who bought this product also purchased
A11529
A11529
A11528
A11528
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies